Volume 17, Issue 2 (Mar-Apr 2023)                   mljgoums 2023, 17(2): 33-38 | Back to browse issues page


XML Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Rafiee M, Tabarraei A, Yazdi M, Mohebbi A, Ghaemi E A. Antimicrobial Resistance Patterns of Staphylococcus saprophyticus Isolates Causing Urinary Tract Infections in Gorgan, North of Iran. mljgoums 2023; 17 (2) :33-38
URL: http://mlj.goums.ac.ir/article-1-1553-en.html
1- Department of Microbiology, Golestan University of Medical Sciences, Gorgan, Iran
2- Department of Biology, Faculty of Sciences, University of Isfahan, Iran
3- Department of Microbiology, Golestan University of Medical Sciences, Gorgan, Iran , eghaemi@yahoo.com
Full-Text [PDF 550 kb]   (2495 Downloads)     |   Abstract (HTML)  (11949 Views)
Full-Text:   (7164 Views)
INTRODUCTION
Urinary tract infection (UTI) is the most frequent bacterial infection following respiratory tract infections, affecting 150 million people around the world every year (1). Gram-negative bacteria, such as Escherichia coli, are the main causative agents of UTIs, accounting for up to 80% of community-acquired uncomplicated UTIs, followed by Klebsiella spp., Enterobacter, and Proteus species. Staphylococcus aureus, Enterococcus spp., and coagulase-negative staphylococci (CoNS) are the most common Gram-positive etiologic agents of UTI (2, 3). Staphylococcus saprophyticus is the most common CoNS and has two subspecies: saprophyticus and bovis. The saprophyticus subspecies is the major cause of uncomplicated UTIs, following uropathogenic E.coli (UPEC) (2). Novobiocin resistance is a laboratory trait that distinguishes this subspecies from others (4). In addition to UTIs in young women, S. saprophyticus has been reported in other infections such as sepsis, acute pyelonephritis, and endocarditis (3).
As a prevalent cause of UTI, the pathogenesis of S. saprophyticus and its virulence factors, exclusively those distinguishing this organism from other CoNS, have not been extensively studied. In addition, epidemiological research about this uropathogenic organism is very limited. The pathogenicity of S. saprophyticus is related to some surface proteins including fibronectin binding autolysin, surface-associated lipase, uro-adherence factor, collagen-binding serine-aspartate-repeat protein, and two cytoplasmic enzymes i.e. D-serine deaminase and urease that have been characterized as necessary for the pathogenesis and attachment to host tissues (5-7).
Today, with the rise of resistance to common drugs, it is essential to study the antibiotic resistance pattern for each known pathogenic bacterium. Recent studies have demonstrated an increase in antibiotic resistance rate in bacteria that cause UTI, particularly E. coli and S. saprophyticus (3, 8). For this reason, the search for new therapeutic modalities such as nanoparticles, bacteriophages, or plant extracts has been considered (9).
In some countries, including Iran, the pathogenicity of S. saprophyticus is less studied. The present study aimed to investigate the pattern of antibiotic resistance among clinical isolates of S. saprophyticus and the possible phenotype and molecular diversity of this bacterium from urine samples in Gorgan, northern Iran.

MATERIALS AND METHODS
This study was performed from May 2018 to September 2020. During this period, clinical isolates of S. saprophyticus were collected from patients with UTI who had been referred to laboratories and hospitals in Gorgan, Iran. Reconfirmation was performed for all isolates using biochemical tests such as catalase, coagulase, urease production, growth on mannitol salt agar medium, and novobiocin resistance test (3). Patient’s demographic information, such as sex and age, was recorded.
For definitive identification of the isolates, the following primers were used to amplify the 16SrRNA gene:  16S forward 5′CATGCAAGTCGAGCGAACAG3′ and 16S reverse 5′TGCGGAAGATTCCCTACTGC3′. The primers were synthesized by Metabion Co., Germany. Amplification was performed according to the following conditions: initial denaturation at 95 °C for 10 minutes (1 cycle), denaturation at 94 °C for 45 seconds, annealing at 58 °C for 30 seconds, extension at 72 °C for 45 seconds (35 cycles), and one final elongation step at 72 °C for 5 minutes (10). Some PCR products were sequenced by Macrogen Co. (South Korea), and the sequences were deposited in GenBank (https://www.ncbi.nlm.nih.gov/genbank/).
Susceptibility of S. saprophyticus isolates to trimethoprim-sulfamethoxazole, tetracycline, ciprofloxacin, nitrofurantoin, gentamicin, chloramphenicol, erythromycin, linezolid, penicillin, clindamycin, and levofloxacin was tested using the disc diffusion method (Kirby Bauer). The results were interpreted according to the clinical and laboratory standards institute guidelines (2019). The antibiotic discs were purchased from Rosco, Denmark.
Statistical analysis of data was carried out in SPSS (version 18.0).
RESULTS
In this study, 35 isolates were confirmed based on culture, biochemical tests, and PCR amplification. All isolates had novobiocin resistance and intense urease activity. Twenty-two isolates (62.9%) were able to ferment mannitol sugar, and about 51.4% of the isolates showed yellow pigment in Muller Hinton Agar (Merck, Germany) after 24 hours of incubation. ​
All S. saprophyticus isolates were from women with UTI aged 4 to 65 years. Most S. saprophyticus isolates (68.6%) were collected in the summer season. Six, two, and three isolates were collected in the autumn, winter, and spring seasons, respectively. Only three S. saprophyticus isolates were collected from hospitalized patients.
After the PCR amplification, a 327 bp fragment was detected for all S. saprophyticucs isolates. The PCR products for 11 cases isolates were sequenced and read by the Chromas software to confirm the amplified gene. The sequences were deposited in GenBank with the following accession numbers: MW453014, MW453015, MW453016, MW453017, MW453018, MW453019, MW453020, MW453021, MW453022, MW453023, and MW453024. The sequencing results demonstrated two closely divergent clades of 16srRNAs (MW453023, MW453024), which have different sequencing patterns (Figure 1).

Figure 1- The sequencing results of 11 S. saprophyticus isolates from patients with UTI in Gorgan, northern Iran.
Table 1- Results of antimicrobial susceptibility testing
Resistant
Number (%)
Susceptible
Number (%)
Antibiotics
0 35(100%) Nitrofurantoin
0 35(100%) Linezolid
3(8.6%) 32(91.4%) Tetracycline
9(25.7%) 26(74.3%) Clindamycin
30(85.7%) 5(14.3%) Penicillin
3(8.6%) 32(91.4%) Ciprofloxacin
2(5.7%) 33(94.3%) Levofloxacin
18(51.4%) 17(48.6%) Erythromycin
8(22.9%) 27(77.1%) Chloramphenicol
0 35(100%) Gentamicin
2(5.7%) 33(94.3%) Trimethoprim-sulfamethoxazole
DISCUSSIONS
S. saprophyticus is the second most common cause of uncomplicated UTI in young women. The clinical symptoms range from asymptomatic bacteriuria to pyelonephritis, perirenal abscesses, acute cystitis, and sepsis. Infection with this bacterium rarely results in hospitalization. As expected, the majority of cases (91.3%) in our study were outpatients; however, a study in Brazil reported the opposite (11).
S. saprophyticus is sensitive to commonly-prescribed antibiotics for UTIs, and this organism is usually susceptible to trimethoprim-sulfamethoxazole (12). As the pattern of antibiotic resistance changes over time, the infection may continue to spread despite the use of antimicrobials. Therefore, studying the pattern of antibiotic resistance in UTI-causing microorganisms can help to predict and control the rise in resistance rates in the future (13). In the present study, all isolates were sensitive to nitrofurantoin, which is in line with the findings of a study conducted in Kermanshah, Iran (14). Due to its mild side effects and very low bacterial resistance rate, nitrofurantoin has been recommended by the Infectious Diseases Society of America as the first-line treatment for uncomplicated UTIs (15).
All isolates were also sensitive to gentamicin. In previous studies, the sensitivity to gentamicin among S. saprophyticus ranged from 63.3% to 86.21% (3, 16). Gentamicin is used for the treatment of complicated infections but not UTI because S. saprophyticus infection occurs as uncomplicated cystitis (17). In our study, all isolates of S. saprophyticus were sensitive to linezolid, which is in agreement with the findings of previous studies (8, 18, 19). Linezolid is used for the treatment of infections caused by methicillin-resistant Staphylococcus aureus and vancomycin-resistant enterococci, as well as complex skin and soft tissue infections. Thus, this antibiotic is prescribed as the last-line treatment for complex infections and is not recommended for the treatment of UTIs (20).
The sensitivity of S. saprophyticus isolates to trimethoprim-sulfamethoxazole in different regions of Iran varies widely. In northern Iran, sensitivity to trimethoprim-sulfamethoxazole is very high (94.3%); therefore, it is recommended as the second-line treatment for uncomplicated UTI. However, studies conducted in other parts of Iran reported sensitivity rates of 30-70% for this drug (21-23). One of the fluoroquinolones that are mostly prescribed for UTIs is ciprofloxacin due to oral and intravenous use and its rapid excretion from the body. In this study, 91.4% of the isolates were susceptible to ciprofloxacin.
Due to the indiscriminate use of antibiotics, the prevalence of multi-drug resistant (MDR) strains is increasing, which is a major health challenge in the world. In previous studies in Iran, 100%, and 58% of S. saprophyticus isolates were MDR, respectively (8, 24). In the present study, 25.7% of the isolates were MDR. This requires finding novel and alternative therapies for the treatment of UTIs caused by MDR strains (25).
The phenotype and genotype diversity of S. saprophyticus has received less attention in recent years, and there is not much information about its typing. In our study, the isolates differed in the fermentation of mannitol sugar and pigment production. Therefore, further studies on this bacterium's phenotype and genotype diversity seem necessary.
Although all S. saprophyticus isolates were mannitol negative in previous reports, and all isolates showed a similar growth pattern on mannitol salt agar, we found that only 13 out of 35 isolates were mannitol negative (8). On the other hand, we found some differences among the isolates regarding pigmentation. By examining the 16SrRNA sequence of 11 isolates, we found that the sequence of two isolates was different from the others, which allows 16SrRNA-based typing. Sequencing results showed that the two isolates (MW43023 and MW43024= S. saprophyticus122 and S. saprophyticus124) differed from the other isolates at eight nucleotide sites. The two isolates also differed in terms of mannitol fermentation. This indicates that there is some dissimilarity between S. saprophyticus isolates, which needs more attention for classification at the subspecies level.
S. saprophyticus is a CoNS that mainly colonize young sexually active women (26). Approximately half of the young women have this bacterium in their urethra (2). Moreover, UTI caused by S. saprophyticus occurs predominantly in young females and women of reproductive age. Shortness of the urethra in women is a key factor that predisposes women to UTIs (27). All S. saprophyticus cases in this study were isolated from women, which is in line with the findings of previous studies in Bangladesh and Iran (3, 23). In previous studies, a seasonal distribution pattern of S. saprophyticus mainly in the summer and autumn seasons has been reported (11, 28). We found that most S. saprophyticus were isolated from the patients in the summer. However, we found no apparent reason for this seasonal distribution.
CONCLUSION
Nitrofurantoin and trimethoprim-sulfamethoxazole are the antibiotics of choice for the treatment of UTI caused by S. saprophyticus in the study area. Due to the phenotypic and genotypic differences among S. saprophyticus isolates, typing of S. saprophyticus at the subspecies level is recommended.
ACKNOWLEDGEMENTS
This study was part of the master’s thesis by Miss Maryam Rafiee at the Golestan University of Medical Sciences. The authors would like to thank the manager and staff of Landa Laboratory in Gorgan for their cooperation.
DECLARATIONS
FUNDING
This study was financially supported by a grant from the Golestan University of Medical Sciences, Gorgan, Iran (Project code: IR.GOUMS.REC.1397.339).
Ethics approvals and consent to participate
Not applicable.
CONFLICT OF INTEREST
The authors declare that there is no conflict of interest regarding the publication of this article.
 
Research Article: Research Article | Subject: bacteriology
Received: 2022/07/20 | Accepted: 2022/10/10 | Published: 2023/03/14 | ePublished: 2023/03/14

References
1. Wong CKM, Kung K, Au-Doung PLW, Ip M, Lee N, Fung A, et al. Antibiotic resistance rates and physician antibiotic prescription patterns of uncomplicated urinary tract infections in southern Chinese primary care. PloS one. 2017;12(5):e0177266. [View at Publisher] [DOI:10.1371/journal.pone.0177266] [PubMed] [Google Scholar]
2. Kline KA, Lewis AL. Gram-positive uropathogens, polymicrobial urinary tract infection, and the emerging microbiota of the urinary tract. Microbiology spectrum. 2016; 4(2): 4.2. 04. [View at Publisher] [DOI:10.1128/microbiolspec.UTI-0012-2012] [PubMed] [Google Scholar]
3. Jhora ST, Paul S. Urinary Tract Infections Caused by Staphylococcus saprophyticus and their antimicrobial sensitivity pattern in Young Adult Women. Bangladesh Journal of Medical Microbiology. 2011;5(1):21-5. [DOI:10.3329/bjmm.v5i1.15817] [Google Scholar]
4. Vickers AA, Chopra I, O'neill AJ. Intrinsic novobiocin resistance in Staphylococcus saprophyticus. Antimicrobial agents and chemotherapy. 2007;51(12):4484-5. [View at Publisher] [DOI:10.1128/AAC.00708-07] [PubMed] [Google Scholar]
5. Kleine B, Gatermann S, Sakinc T. Genotypic and phenotypic variation among Staphylococcus saprophyticus from human and animal isolates. BMC research notes. 2010; 3(1):1-5. [View at Publisher] [DOI:10.1186/1756-0500-3-163] [PubMed] [Google Scholar]
6. Al-Waeely FA, AL-khafaji JK, Al-Saadi ZH. CHARACTERIZATION OF VIRULENCE FACTORS OF STAPHYLOCOCUS SAPROPHYTICUS ISOLATED FROM WOMEN WITH CYSTITIS. 2015. [View at Publisher] [Google Scholar]
7. de Paiva-Santos W, de Sousa VS, Giambiagi-deMarval M. Occurrence of virulence-associated genes among Staphylococcus saprophyticus isolated from different sources. Microbial pathogenesis. 2018;119:9-11. [View at Publisher] [DOI:10.1016/j.micpath.2018.03.054] [PubMed] [Google Scholar]
8. Hashemzadeh M, Dezfuli A, Nashibi R, Jahangirimehr F, Akbarian Z. Study of biofilm formation, structure and antibiotic resistance in Staphylococcus saprophyticus strains causing urinary tract infection in women in Ahvaz, Iran. New Microbes and New Infections. 2021;39:100831. [View at Publisher] [DOI:10.1016/j.nmni.2020.100831] [PubMed] [Google Scholar]
9. Ujmajuridze A, Chanishvili N, Goderdzishvili M, Leitner L, Mehnert U, Chkhotua A, et al. Adapted bacteriophages for treating urinary tract infections. Frontiers in microbiology. 2018;9:1832. [DOI:10.3389/fmicb.2018.01832] [PubMed] [Google Scholar]
10. Ghebremedhin B, Layer F, Konig W, Konig B. Genetic classification and distinguishing of Staphylococcus species based on different partial gap, 16S rRNA, hsp60, rpoB, sodA, and tuf gene sequences. Journal of clinical microbiology. 2008;46(3):1019-25. [View at Publisher] [DOI:10.1128/JCM.02058-07] [Google Scholar]
11. Lo DS, Shieh HH, Barreira ER, Ragazzi SLB, Gilio AE. High frequency of Staphylococcus saprophyticus urinary tract infections among female adolescents. The Pediatric infectious disease journal. 2015;34(9):1023-5. [View at Publisher] [DOI:10.1097/INF.0000000000000780] [Google Scholar]
12. Jancel T, Dudas V. Management of uncomplicated urinary tract infections. Western journal of medicine. 2002;176(1):51. [DOI:10.1136/ewjm.176.1.51] [PubMed] [Google Scholar]
13. Chen L-K, Kuo S-C, Chang K-C, Cheng C-C, Yu P-Y, Chang C-H, et al. Clinical antibiotic-resistant Acinetobacter baumannii strains with higher susceptibility to environmental phages than antibiotic-sensitive strains. Scientific reports. 2017;7(1):1-10. [View at Publisher] [DOI:10.1038/s41598-017-06688-w] [PubMed] [Google Scholar]
14. Bartani Z, Shokry E, Sadeghi M, Abdi H. The prevalence of bacterial sensitivity and resistance in non-complicated urinary tract infection in outpatient with urinary tract infection in Kermanshah city. Medical Science. 2018;22(89):78-84. [View at Publisher] [Google Scholar]
15. Flores-Mireles AL, Walker JN, Caparon M, Hultgren SJ. Urinary tract infections: epidemiology, mechanisms of infection and treatment options. Nature reviews microbiology. 2015;13(5):269-84. [View at Publisher] [DOI:10.1038/nrmicro3432] [PubMed] [Google Scholar]
16. Iliyasu M, Ezihe M, Bala K. Antibiogram pattern of staphylococcus saprophyticus associated with asymptomatic bacteriuria among pregnant women attending antenatal clinics in bauchi metropolis. Nigerian Journal of Microbiology. 2015;28:2812-20.
17. Cox L, He C, Bevins J, Clemens JQ, Stoffel JT, Cameron AP. Gentamicin bladder instillations decrease symptomatic urinary tract infections in neurogenic bladder patients on intermittent catheterization. Canadian Urological Association Journal. 2017;11(9):E350. [DOI:10.5489/cuaj.4434] [PubMed] [Google Scholar]
18. Sarvepalli VK, Patak NP, Kandati J, Pathapati RM, Buchineni M. Prevalence of uropathogens and their antibiogram in diabetic patients a cross sectional study. Int J Curr Microbiol App Sci. 2015;4(11):226-35. [PubMed] [Google Scholar]
19. Moue A, Aktaruzzaman S, Ferdous N, Karim MR, Khalil M, Das AK. Prevalence of urinary tract infection in both outpatient department and in patient department at a medical college setting of Bangladesh. Int J Biosci. 2015;7(5):146-52. [DOI:10.12692/ijb/7.5.146-152] [Google Scholar]
20. Perry CM, Jarvis B. Linezolid: a review of its use in the management of serious gram-positive infections. Drugs. 2001; 61(4): 525-51. [View at Publisher] [DOI:10.2165/00003495-200161040-00008] [PubMed] [Google Scholar]
21. Khoshbakht R, Salimi A, SHIRZAD AH, Keshavarzi H. Antibiotic susceptibility of bacterial strains isolated from urinary tract infections in Karaj, Iran. Jundishapur Journal of Microbiology. 2013; 6(1): 86-90. [DOI:10.5812/jjm.4830] [Google Scholar]
22. Motamedifar M, Zamani K, Hassanzadeh Y, Pashoutan S. Bacterial etiologies and antibiotic susceptibility pattern of urinary tract infections at the pediatric ward of Dastgheib hospital, Shiraz, Iran: A three-year study (2009-2011). Archives of Clinical Infectious Diseases. 2016;11(2). [View at Publisher] [DOI:10.5812/archcid.28973] [Google Scholar]
23. Naderi M, Gholipour N, Mashjoor S, Moradi N, Samaei NM. Spectrum of Bacterial Resistance associated with Urinary Tract Infections from Clinical case in Northern of Iran. Advances in Bioresearch. 2018;9(1). [View at Publisher] [Google Scholar]
24. Yazdi M, Bouzari M, Ghaemi EA. Isolation and characterization of a potentially novel Siphoviridae phage (vB_SsapS-104) with lytic activity against Staphylococcus saprophyticus isolated from urinary tract infection. Folia microbiologica. 2019; 64(3): 283-94. [View at Publisher] [DOI:10.1007/s12223-018-0653-9] [PubMed] [Google Scholar]
25. Bagińska N, Cieślik M, Górski A, Jończyk-Matysiak E. The Role of Antibiotic Resistant A. baumannii in the Pathogenesis of Urinary Tract Infection and the Potential of Its Treatment with the Use of Bacteriophage Therapy. Antibiotics. 2021;10(3):281. [View at Publisher] [DOI:10.3390/antibiotics10030281] [PubMed] [Google Scholar]
26. Vincent CR, Thomas TL, Reyes L, White CL, Canales BK, Brown MB. Symptoms and risk factors associated with first urinary tract infection in college age women: a prospective cohort study. The Journal of urology. 2013;189(3):904-10. [View at Publisher] [DOI:10.1016/j.juro.2012.09.087] [PubMed] [Google Scholar]
27. Vasudevan R. Urinary tract infection: an overview of the infection and the associated risk factors. J Microbiol Exp. 2014;1(2):00008. [DOI:10.15406/jmen.2014.01.00008] [Google Scholar]
28. Adeghate J, Juhász E, Pongrácz J, Rimanóczy É, Kristóf K. Does Staphylococcus saprophyticus cause acute cystitis only in young females, or is there more to the story? A one-year comprehensive study done in Budapest, Hungary. Acta Microbiologica et Immunologica Hungarica. 2016;63(1):57-67. [View at Publisher] [DOI:10.1556/030.63.2016.1.4] [PubMed] [Google Scholar]

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.